resource source identifier vectashield antifade mounting medium vector (Vector Laboratories)

Vector Laboratories is a verified supplier

Vector Laboratories manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Vector Laboratories resource source identifier vectashield antifade mounting medium vector
Resource Source Identifier Vectashield Antifade Mounting Medium Vector, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 99/100, based on 25513 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/source+vector/VECTASHIELD+Antifade+Mounting+Medium/pm41529684-249-2-9
Average 99 stars, based on 25513 article reviews

resource source identifier vectashield antifade mounting medium vector - by Bioz Stars, 2026-11

99/100 stars

Images

Incubation:

Article Title: Introducing PIGMO, a novel PIGmented MOuse model of Parkinson's disease.
Article Snippet: .. AR TI CL E IN P RE SS Table 2: Number of neurons used for quantifying intracellular neuromelanin levels Time post-injection NMel+ neurons (SNpc) NMel+ neurons (VTA) NMel+ neurons (LC) Total NMel+ neurons 1 month Mouse #1: 83 Mouse #2: 57 Mouse #3: 49 Mouse #1: 8 Mouse #2: 9 Mouse #3: 8 Mouse #1: 0 Mouse #2: 0 Mouse #3: 0 214 4 months Mouse #4: 206 Mouse #5: 236 Mouse #6: 167 Mouse #4: 45 Mouse #5: 17 Mouse #6: 106 Mouse #4: 0 Mouse #5: 0 Mouse #6: 9 786 8 months Mouse #7: 194 Mouse #8: 187 Mouse #9: 125 Mouse #7: 113 Mouse #8: 99 Mouse #9: 79 Mouse #7: 10 Mouse #8: 39 Mouse #9: 23 869 12 months Mouse #10: 164 Mouse #11: 186 Mouse #12: 129 Mouse #10: 114 Mouse #11: 12 Mouse #12: 71 Mouse #10: 25 Mouse #11: 18 Mouse #12: 55 774 Total NMel+ neurons 1783 681 179 2643 Mouse anti--synuclein (monoclonal) 1:40 Overnight Leica Cat# NCL-L-ASYN AB_442103 Mouse anti--synuclein P-Ser129 (monoclonal) 1:1000 Overnight Fujifilm Wako Cat#015-25191 AB_2537218 Guinea Pig anti-P62 (polyclonal) 1.1000 Overnight PROGEN Cat# GP62-C AB_2687531 Mouse anti-ubiquitin (monoclonal) 1:500 Overnight Abcam Cat# ab7254 AB_305802 Donkey anti-Goat (Biotin-SP) 1:600 120 min Jackson Cat# 705-065-147 AB_2340397 Donkey anti-Goat (Alexa488) 1.200 120 min Molecular Probes Cat# A-11055 AB_2534102 Donkey anti-Goat (Alexa350) 1.200 120 min Molecular Probes Cat# A-21081 AB_141521 Donkey anti-Goat (Alexa 633) 1:200 120 min Molecular Probes Cat# A-21082 AB_141493 Donkey anti-Guinea Pig (Alexa594) 1:200 120 min Jackson Cat# 706-585-148 Donkey anti-Mouse (Alexa488) 1:200 120 min Molecular Probes Cat# A-21202 AB_141607 Donkey anti-Mouse (Alexa546) 1:200 120 min Thermo Fisher Cat# A-10036 AB_11180613 Donkey anti-Rabbit (Alexa488) 1:200 120 min Molecular Probes Cat# A-21206 AB_2535792 Commercial assays Dilution Incubation time Source Identifier ABC Kit Standard 60 min Vector Labs Cat# PK-4000 Neutral Red 0.40% 1 min Sigma Cat# 72210 Peroxidase chromogen V-VIP 1 min Vector Labs Cat# SK-4600 Proteinase K 1 mg/ml 10 min Invitrogen Cat# 25530049 ..

Enzyme-linked Immunosorbent Assay:

Article Title: Angiopoietin-2 aggravates Alzheimer's disease by promoting blood-brain barrier dysfunction and neuroinflammation.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-mouse CD31 Thermo Fisher Scientific Cat#MA3105; RRID: AB_223592 Anti-mouse β-amyloid Abcam Cat#ab2539; RRID: AB_303141, Cat#ab126649; RRID: AB_3095985 Anti-mouse TIE2 Regeneron Pharmaceuticals Inc. Cat#REGN1376 Anti-mouse pTIE2 R&D Systems Cat#AF2720; RRID: AB_442172 Anti-mouse ANGPT2 Regeneron Pharmaceuticals Inc. Cat#REGN910 Anti-mouse PDGFRβ Thermo Fisher Scientific Cat#14-1402-82; RRID: AB_467493 Anti-mouse Fibrin(ogen) Dako Cat#A0080; RRID: AB_2894406 Anti-mouse GFAP Aves Lab Cat#GFAP; RRID: AB_2313547 Anti-mouse S100β Abcam Cat#ab52642; RRID: AB_882426 Anti-mouse Iba1 Fujifilm Wako Cat#019-19741; RRID: AB_839504 Anti-mouse CD74 BioLegend Cat#151002; RRID: AB_2566502 Anti-mouse Claudin-5 Thermo Fisher Scientific Cat#34-1600; RRID: AB_2533157 Anti-mouse Occludin Thermo Fisher Scientific Cat#71-1500; RRID: AB_2533977 Anti-mouse PLVAP BD Biosciences Cat#550563; RRID: AB_393754 Anti-mouse Caveolin-1 Santa Cruz Biotechnology Cat#sc53564; RRID: AB_628859 Anti-human ANGPT2 R&D Systems Cat#MAB098; RRID: AB_2242618 Anti-human VE-cadherin R&D Systems Cat#AF938; RRID: AB_355726 Anti-human CD31 DAKO Cat#M0823; RRID: AB_2114471 Anti-human TIE2 R&D Systems Cat#AF762; RRID: AB_2203220 Anti-human pTIE2 R&D Systems Cat#AF2720; RRID: AB_442172 Anti-human Mfsd2a Cell Signaling Technology Cat#80302 Anti-human EphB4 R&D Systems Cat#AF446; RRID: AB_2100105 Anti-human αSMA Sigma-Aldrich Cat#C6198; RRID: AB_476856 Bacterial and virus strains pUCmini-iCAP-AAV9-X1.1 Chen et al. 42 Addgene plasmid Cat#196836; RRID: Addgene_196836 AAV9-X1.1-CAG-EGFP (Control AAV) This study N/A AAV9-X1.1-CAG-ANGPT2-p2A-EGFP (ANGPT2 AAV) This study N/A Biological samples Postmortem fresh-frozen human brain samples Alzheimer’s Disease Research Center (ADRC) at Columbia University N/A Human CSF samples Alzheimer’s Disease Research Center (ADRC) at Columbia University N/A Chemicals, peptides, and recombinant proteins Tamoxifen Sigma-Aldrich Cat#T5648 Cadaverine Invitrogen Cat#A30677 DyLight 649–conjugated tomato lectin Vector Laboratories Cat#DL-1178 10% Neutral Buffered Formalin Epredia Cat#5735 Normal Donkey Serum Jackson ImmunoResearch Cat#017-000-121 Normal Goat Serum Jackson ImmunoResearch Cat#005-000-121 DAPI Sigma-Aldrich Cat#D9542 Hoechst 33342 Thermo Fisher Scientific Cat#H3570; RRID: AB_3675235 (Continued on next page) 18 Cell Reports ▪▪, 116621, ▪▪, 2025 OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER VECTASHIELD Antifade Mounting Medium Vector CatH-1000; RRID: AB_2336789 Critical commercial assays ProcartaPlex Mouse Cytokine & Chemokine Panel 1 26plex Invitrogen Cat#EPX260-26088-901 DuoSet ELISA kit R&D Systems Cat#DANG20 Deposited data Mouse snRNA-sequencing data GEO GSE286360 (secure token: apanciaoflqdnsn) ROSMAP snRNA-sequencing data Synapse syn31512863 Code GitHub https://github.com/ssun1116/AD_ SingleCell Experimental models: Organisms/strains Mouse: 6 and 18 months old inbred male and female wild-type/C57BL/6 The Jackson Laboratory, The National Institute on Aging IMSR_JAX:000664 Mouse: 6 and 18 months old inbred male and female 5xFAD/C57BL/6 The Jackson Laboratory MMRRC_034848-JAX Mouse: 12 months old inbred male and female 5xFAD;ANGPT2 flox/flox ;VE-cadherinCreER T2 /C57BL/6 Lee et al. 63 ; Shen et al. 64 ; Sorensen et al. 65 – Oligonucleotides 5xFAD WT/MT Forward (5’ - ACCCCCATGTCAGAGTTCCT - 3 ′ ) Thermo Fisher Scientific N/A 5xFAD MT Reverse (5’ - CGGGCCTCTTCGCTATTAC - 3 ′ ) Thermo Fisher Scientific N/A 5xFAD WT Reverse (5’ - TATACAACCTTGGGGGATGG - 3 ′ ) Thermo Fisher Scientific N/A ANGPT2 flox Forward (5’ - AAGCTTGCCATGTCCAAGCTC - 3 ′ ) Thermo Fisher Scientific N/A ANGPT2 flox Reverse (5’ - TGATCTTACAGTGCCCACGCAG - 3 ′ ) Thermo Fisher Scientific N/A VEcad-creER T2 Forward (5’ - AAGTTCATCTGCACCACCG - 3 ′ ) Thermo Fisher Scientific N/A VEcad-creER T2 Reverse (5’ - TCCTTGAAGAAGATGGTGCG - 3 ′ ) Thermo Fisher Scientific N/A Software and algorithms Zen Zeiss Version 3.12 ImageJ NIH Version 1.54g Prism GraphPad 10 GraphPad Version 10.5.0 Biorender Biorender N/A CellRanger 10X Genomics Version 6.0.0 Version 6.1.2 R package Seurat Satija Lab Version 4.1.3 DecontX celda Version 1.20.0 SingleR Bioconductor Version 1.8.1 fgsea Bioconductor Version 1.20.0 clusterProfiler Bioconductor Version 4.2.2 Scrublet Allon Klein Lab Version 0.2.1 Scanpy Theis Lab Version 1.8.2 Harmony Bioconductor Version 0.0.5 decoupler Bioconductor Version 1.6.0 (Continued on next page) Cell Reports ▪▪, 116621, ▪▪, 2025 19 OPEN ACCESS ..

Software:

Next-Generation Sequencing:

Article Title: A human CAGinSTEM platform for decoding HTT repeats' somatic instability links CAG interruption to HD pathology in neurons.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse monoclonal anti-OCT3/4 (C-10) Santa Cruz Biotechnology Cat#sc-5279; RRID:AB_628051 Rabbit anti-SOX2 Millipore Cat# AB5603; RRID:AB_2286686 Rabbit βIII-TUBULIN BioLegend Cat# 802001; AB_2564645 Mouse monoclonal anti-MAP2 Clone Ap20 BD Biosciences Cat# 556320; RRID:AB_396359 Rabbit polyclonal anti-Ki67 Abcam Cat#ab15580; RRID:AB_443209 Mouse anti-p27 Cell Signaling Cat#3698; RRID:AB_2077832 Rabbit anti GABA Sigma Cat#A2052; RRID:AB_477652 Rat monoclonal anti-CTIP2 [25B6] Abcam Cat#ab18465; RRID:AB_2064130 Rabbit monoclonal anti-DARPP32 [EP720Y] Abcam Cat# ab40801; RRID:AB_731843 Mouse monoclonal anti-GAD67 Millipore Cat# MAB5406; RRID:AB_2278725 Rabbit monoclonal EZH2 (D2C9) Cell Signaling Cat# 5246;RRID:AB_10694683 Rabbit H3K9me3 Abcam Cat# ab8898; RRID:AB_306848 Mouse monoclonal Lamin b1 Merk Cat# amab91251; N/A Rabbit monoclonal Huntingtin (D7F7) Cell Signaling Cat# 5656;RRID:AB_10827977 Rabbit EZH2 Cell Signaling Cat# 4905; RRID:AB_2278249 Rabbit Polyclonal SUZ12 Active Motif Cat# 39357; RRID: AB_2614929 EED Abcam Cat# ab240650; RRID: AB_2922803 Rabbit polyclonal H3K27Me3 Millipore Cat# 07–449; RRID: AB_310624 Rabbit polyclonal H3 Abcam Cat# ab1791; N/A Mouse Monoclonal Vinculin Sigma Cat# V9131; RRID: AB_477629 AlexaFluor Goat Anti-Rabbit 488 Life Technologies Cat#A11008; RRID:AB_143165 AlexaFluor Goat Anti-Mouse 568 Life Technologies Cat#A11004; RRID:AB_2534072 AlexaFluor Goat Anti-Rat 647 Life Technologies Cat#A21247; RRID:AB_141778 HRP-conjugated Goat anti-Rabbit IgG Bio-Rad Cat#170–6515; RRID:AB_11125142 HRP-conjugated Goat anti-Mouse IgG Bio-Rad Cat#170–6516; RRID:AB_11125547 Chemicals, peptides, and recombinant proteins B27 Supplement Life Technologies 17504–044 B27 w/o Vit A supplement Life Technologies 12587–010 brain-derived neurotrophic factor (BNDF) PeproTech 450–02 Cell Culture water Sigma Aldrich W4502-1L Cultrex Bio-Techne 343201001 DKK-1 PeproTech 120–30 DMEM/F12 Life Technologies 21331–020 Dulbecco’s PBS w/o Calcium w/o Magnesium (PBS) Euroclone ECB40041 EDTA 0.5M pH 8.0 Millipore 324506 ESGRO Complete Accutase Millipore SF006 GlutaMAX (100×) Life Technologies 35050–38 HaltTM Protease and Phosphatase Inhibitor Cocktail 1 mM Thermo Fisher Scientific 78440 Hoechst 33342 Invitrogen H3570 LDN CHDI Foundation 00396388-0001-006 mTeSRTM1 basal medium STEMCELL Technologies 85851 mTeSRTM1 Supplement (5×) STEMCELL Technologies 85851 (Continued on next page) 18 Cell Reports 44, 116685, December 23, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Normal Goat Serum (NGS) Vector Laboratories S-1000 N2 Supplement Life Technologies 17502–048 Penicillin/Streptomycin solution (100×) Euroclone ECB3001D PMSF 1mM Sigma Aldrich P7626 ProLong Diamond ThermoFisher Scientific P36961 Y-27632 (ROCKi) CHDI Foundation 00197406-0001-007 SB431542 CHDI Foundation 00447536-0000-002 SHH C-25 II R&D System 464-SH-2MG Trypan Blue Solution Life Technologies 15250–06 TRIzolTM Reagent Life Technologies 15596018 SCR7 TOCRIS 14892-97-8 G418 ThermoFisher 10131027 SPRIselect beads Beckman Coulter B23318 Paraformaldehyde (PFA) Sigma-Aldrich P6148 Critical commercial assays Clarity Western ECL Substrate Bio-Rad 1705061 DNA-freeTM DNase Treatment and Removal Thermo Fisher Scientific AM1906 iScript cDNA Synthesis Kit Bio-Rad 1708891 Bio-Rad 1708891 NucleoSpin Tissue® kit Machery-Nagel 740952 Human Stem Cell Nucleofector® Kit Lonza VPH-5012 PrimeSTAR® HS DNA Polymerase with GC Buffer Takara R044A Phusion High–Fidelity DNA Polymerase Thermo Fisher F530S PrimeStar Max Polymerase Takara R045A Q5® High-Fidelity DNA Polymerase NEB M0491 Ligation sequencing kit ONT SQK-LSK110 Native barcoding kit ONT EXP-NBD104 EXP-NBD114 Pierce BCA Protein Assay Kit Thermo Fisher Scientific 23225 SsoFast EvaGreen’’ Supermix Bio-Rad 172–5202 Deposited data Raw genomic sequencing data NCBI SRA BioProject PRJNA1074134 https://www. ncbi.nlm.nih.gov/sra/?term=PRJNA1074134 Raw transcriptomic sequencing data NCBI SRA BioProject PRJNA1074134 https://www. ncbi.nlm.nih.gov/sra/?term=PRJNA1074134 Experimental models: Cell lines Human: H9 (WA-09) hESC line WiCell Research Institute NIHhESC-10-0062 H9-RMCE parental 107Q/(CAG) 105 -CAACAG This paper N/A H9-21Q/(CAG) 19 -CAACAG This paper N/A H9-45Q/(CAG) 43 -CAACAG This paper N/A H9-81Q/(CAG) 78 -CAACAG This paper N/A H9-107Q CAACAG-dup This paper N/A H9-107Q multi-CAAs This paper N/A H9-83Q CAACAG-dup This paper N/A H9-43Q CAA-loss This paper N/A H9-107Q CAA-loss This paper N/A Experimental models: Organisms/strains Primers sequence for PCR and qRT-PCR see Table S2 This paper N/A (Continued on next page) Cell Reports 44, 116685, December 23, 2025 19 .. hES cell culture Human embryonic stem (hES) H9 female cell line (WiCell) and derived edited clones were cultured on cultrex (80–120 μg/mL, BioTechne)-coated dishes in complete mTeSR1 medium (STEMCELL Technologies) plus 1× Penicillin/Streptomycin solution (Euroclone).

Western Blot:

cDNA Synthesis:

Ligation:

Sequencing:

Bicinchoninic Acid Protein Assay:

Genomic Sequencing:

Polymerase Chain Reaction:

Quantitative RT-PCR:

Double Staining:

Article Title: Repeat-associated non-AUG translation as a common mechanism for the polyGln ataxias.
Article Snippet: UF Center for NeuroGenetics banking program. https://neurogenetics. med.ufl.edu Chemicals, peptides, and recombinant proteins Background Sniper BioCare Medical Cat. # BS966MM Rabbit linking reagent BioLegend Cat. # 93030 VECTASTAIN® ABC HRP Detection kit Vector Laboratoires Cat. # PK-4000 Hematoxylin QS Counterstain Vector Laboratoires Cat. # H-3404-100 Critical commercial assays Vector NovaRED Substrate Kit, Peroxidase Vector Laboratories Cat. # SK-4800 ImmPRESS® Duet Double Staining Polymer Kit (HRP Anti-Mouse IgG-brown, AP Anti-Rabbit IgG-magenta) Vector Laboratories Cat. # MP-7724-15 (Continued on next page) Cell Reports 45, 116741, January 27, 2026 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER ImmPRESS® Duet Double Staining Polymer Kit (HRP – Anti-Rabbit IgG-brown, AP – Anti-Mouse IgG-magenta) Vector Laboratories Cat. # MP-7714-15 CytoTox 96® Non-Radioactive Cytotoxicity Assay Promega Cat. #G1780 Experimental models: Cell lines Human: HEK293T ATCC CRL-3216 Human: T98 ATCC CRL-1690 Human: N2A ATCC CCL-131 Experimental models: Organisms/strains Mouse: SCA3 YAC, ATXN3 wt/Q84 (MJD84.2. .. B6;CBA-Tg(ATXN3*)84.2Cce/IbezJ) The Jackson Laboratory JAX #012705; RRID: IMSR_JAX:012705 Mouse: SCA1 knock-in, ATXN1wt/Q154 (Atxn1154Q/2Q, B6.129S7-Atxn1tm1Hzo/J) The Jackson Laboratory JAX #005601; RRID: IMSR_JAX:005601 Mouse: Pcp2-ATXN1[82Q], Pcp2-82Q, Tg(Pcp2-ATXN1*82Q)5Horr Burright et al. 99 RRID: MGI:6113813 Mouse: Pcp2-ATXN1[82Q]V591A/S602D, V591A/S602D (Tg(Pcp2-ATXN1*82Q*V591A*S602D)1BHorr) Rousseaux et al. 100 RRID: MGI:6113692 Recombinant DNA Flag-Ser-Ct Banez-Coronel et al. 15 N/A Flag-Leu-Ct Banez-Coronel et al. 15 N/A pCDNA3.1-3XFlag-(AGC)15 (Figure S1A) This paper N/A pCDNA3.1-3XFlag-(AGC)30 (Figure S1A) This paper N/A pCDNA3.1-3XFlag-(AGC)45 (Figure S1A) This paper N/A pCDNA3.1-3X Flag-(AGC)60 (Figure S1A) This paper N/A pCDNA3.1-3X Flag-(CTG)15 (Figure S1A) This paper N/A pCDNA3.1-3X Flag-(CTG)30 (Figure S1A) This paper N/A pCDNA3.1-3X Flag-(CTG)45 (Figure S1A) This paper N/A pCDNA3.1-3X Flag-(CTG)60 (Figure S1A) This paper N/A pCDNA3.1-3X Flag-SCA1⋅SER-(TCCTCT)35-Ct (Figures 7A and 7B) This paper N/A pCDNA3.1-3X Flag-SCA2⋅SER-(TCCTCT)35-Ct (Figures 7A and 7B) This paper N/A pCDNA3.1-3X Flag-SCA3⋅SER-(TCCTCT)35-Ct (Figures 7A and 7B) This paper N/A pCDNA3.1-3X Flag-SCA6⋅SER-(TCCTCT)15-Ct (Figures 7A and 7B) This paper N/A pCDNA3.1-3X Flag-SCA7⋅SER-(TCCTCT)35-Ct (Figures 7A and 7B) This paper N/A pCDNA3.1-3X Flag-SCA1⋅LEU-(CTTCTC)35-Ct (Figures 7A and 7B) This paper N/A pCDNA3.1-3X Flag-SCA2-(LEU)-(CTTCTC)35-Ct (Figures 7A and 7B) This paper N/A pCDNA3.1-3X Flag-SCA1-(LEU)-(CTTCTC)35-Ct (Figures 7A and 7B) This paper N/A pCDNA3.1-3X Flag-SCA1-(LEU)-(CTTCTC)15-Ct (Figures 7A and 7B) This paper N/A pCDNA3.1-3X Flag-SCA1-(LEU)-(CTTCTC)35-Ct (Figures 7A and 7B) This paper N/A pCDNA1-Flag-ATXN1[CAG]2 Skinner et al. 101 Addgene plasmid # 33235 pCDNA1-Flag -ATXN1[CAG]85 Skinner et al. 101 Addgene plasmid # 33237 pCDNA1-Flag -ATXN1[CAA]85 (Figures 7F and S6B–S6E) This paper N/A pCDNA1-Flag-ATXN2[CAG]20 (Figures 7F and S6B–S6E) This paper N/A pCDNA1-Flag -ATXN2[CAG]85 (Figures 7F and S6B–S6E) This paper N/A pCDNA1-Flag -ATXN2[CAA]85 (Figures 7F and S6B–S6E) This paper N/A pCDNA3.1-ATXN3[CAG]20-3T (Figures 7F and S6B–S6E) This paper N/A pCDNA3.1-ATXN3[CAG]80-3T (Figures 7F and S6B–S6E) This paper N/A pCDNA3.1-ATXN3[CAA]80-3T (Figures 7F and S6B–S6E) This paper N/A pCDNA3.1-Flag-CACNA1A[CAG]13 (Figures 7F and S6B–S6E) This paper.

Polymer:

Cytotoxicity Assay:

Plasmid Preparation:

Article Title: Mutational analysis of Yih1 and IMPACT reveals amino acids required for Gcn2 inhibition.
Article Snippet: Edited by Michael Ibba In response to amino acid starvation, the protein kinase Gcn2 phosphorylates the eukaryotic translation initiation factor eIF2a, allowing cells to adapt to adverse conditions.. Gcn2 function requires direct binding to effector protein Gcn1 via the Gcn2 RWD-domain.. The orthologues yeast Yih1 and mammalian IMPACT also contain an RWD-domain that can bind Gcn1, thereby impairing the Gcn2-Gcn1 interaction.

Review